Review





Similar Products

94
Sino Biological plasmid encoding sod2
Contribution of superoxide to the EPR signal decay rate in vivo. (A) Western blot of expression of <t>SOD2</t> in wild-type 4T1 breast cancer cell and 4T1 cells transfected with a plasmid encoding SOD 2, after passages 1, 4 and 6. Student's t-test, n = 3, ∗∗; p < 0.01 (B) Decay rates of nitroxides in vivo for 4T1-SOD2 tumors compared to wild-type 4T1 tumors. Bars represent means ± SEM. n = 6/group, Student's t-test, ∗; p < 0.05. (C) EPR signal decay of MitoTEMPO (25 μmol/kg) in vivo. Points represent means ± SEM. n = 6/group, two-way ANOVA with Sidak's correction, ∗; p < 0.05.
Plasmid Encoding Sod2, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid encoding sod2/product/Sino Biological
Average 94 stars, based on 1 article reviews
plasmid encoding sod2 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

93
R&D Systems mnsod
Contribution of superoxide to the EPR signal decay rate in vivo. (A) Western blot of expression of <t>SOD2</t> in wild-type 4T1 breast cancer cell and 4T1 cells transfected with a plasmid encoding SOD 2, after passages 1, 4 and 6. Student's t-test, n = 3, ∗∗; p < 0.01 (B) Decay rates of nitroxides in vivo for 4T1-SOD2 tumors compared to wild-type 4T1 tumors. Bars represent means ± SEM. n = 6/group, Student's t-test, ∗; p < 0.05. (C) EPR signal decay of MitoTEMPO (25 μmol/kg) in vivo. Points represent means ± SEM. n = 6/group, two-way ANOVA with Sidak's correction, ∗; p < 0.05.
Mnsod, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mnsod/product/R&D Systems
Average 93 stars, based on 1 article reviews
mnsod - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

92
Cusabio sod2
High level of epinephrine induces intracellular oxidative stress in oral keratinocytes. (A) HOK-16B cells treated with PBS or epinephrine for 24 h were subjected to CellROX staining. Nuclear DAPI signal is shown in blue (left). The relative CellROX signal intensities are shown (right). Each symbol means an individual cell. (B) Immunoblot analysis of <t>SOD2</t> and SESN2 in HOK-16B cells treated with epinephrine for 24 h. β ACTIN was used as loading control. (C) Relative band intensities are shown. (D) Relative mRNA expression of TNFα, IL6, and IL8 in HOK-16B cells treated with epinephrine for 3 h. ** P < 0.01; *** P < 0.001. n.s , not significant.
Sod2, supplied by Cusabio, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sod2/product/Cusabio
Average 92 stars, based on 1 article reviews
sod2 - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

93
Cusabio superoxide dismutase
High level of epinephrine induces intracellular oxidative stress in oral keratinocytes. (A) HOK-16B cells treated with PBS or epinephrine for 24 h were subjected to CellROX staining. Nuclear DAPI signal is shown in blue (left). The relative CellROX signal intensities are shown (right). Each symbol means an individual cell. (B) Immunoblot analysis of <t>SOD2</t> and SESN2 in HOK-16B cells treated with epinephrine for 24 h. β ACTIN was used as loading control. (C) Relative band intensities are shown. (D) Relative mRNA expression of TNFα, IL6, and IL8 in HOK-16B cells treated with epinephrine for 3 h. ** P < 0.01; *** P < 0.001. n.s , not significant.
Superoxide Dismutase, supplied by Cusabio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/superoxide dismutase/product/Cusabio
Average 93 stars, based on 1 article reviews
superoxide dismutase - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

91
Boster Bio uperoxide dismutase sod2
Fig. 7. Kaempferol inhibits autophagy and attenuates oxidative stress in RA-FLS cells. (A) RA-FLS cells were treated with different concentrations of kaempferol, cellular reactive oxygen species were detected by DCFH- DA, and cell membrane potential was detected by JC-1, Scale bar is 100 μm. (B) RA-FLS cells were treated with different concentrations of kaempferol and protein expression of <t>SOD2</t> was detected by Western blot. (C) In different concentrations of kaempferol-treated RA-FLS cells, Western blot detected protein expression of P62, LC3B. *P < 0.05; **P < 0.01; ***P < 0.001.
Uperoxide Dismutase Sod2, supplied by Boster Bio, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/uperoxide dismutase sod2/product/Boster Bio
Average 91 stars, based on 1 article reviews
uperoxide dismutase sod2 - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

96
Proteintech rabbit anti human sod2
Multiple fluorescence staining of tissues samples from ESCC patients. (A, B) Validation of high and low expression level of c5_TYMS in ESCC tumor tissues samples and spatial distribution with microphages and fibroblasts. (C, D) Validation of high and low expression of level <t>c4_SOD2</t> in ESCC tumor tissue samples and spatial distribution with microphages and fibroblasts.
Rabbit Anti Human Sod2, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti human sod2/product/Proteintech
Average 96 stars, based on 1 article reviews
rabbit anti human sod2 - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

90
Genechem adenovirus encoding the human sod2 gene
Multiple fluorescence staining of tissues samples from ESCC patients. (A, B) Validation of high and low expression level of c5_TYMS in ESCC tumor tissues samples and spatial distribution with microphages and fibroblasts. (C, D) Validation of high and low expression of level <t>c4_SOD2</t> in ESCC tumor tissue samples and spatial distribution with microphages and fibroblasts.
Adenovirus Encoding The Human Sod2 Gene, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/adenovirus encoding the human sod2 gene/product/Genechem
Average 90 stars, based on 1 article reviews
adenovirus encoding the human sod2 gene - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

99
OriGene mouse sod2 forward 50 taacgcgcagatcatgcagctg
Multiple fluorescence staining of tissues samples from ESCC patients. (A, B) Validation of high and low expression level of c5_TYMS in ESCC tumor tissues samples and spatial distribution with microphages and fibroblasts. (C, D) Validation of high and low expression of level <t>c4_SOD2</t> in ESCC tumor tissue samples and spatial distribution with microphages and fibroblasts.
Mouse Sod2 Forward 50 Taacgcgcagatcatgcagctg, supplied by OriGene, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse sod2 forward 50 taacgcgcagatcatgcagctg/product/OriGene
Average 99 stars, based on 1 article reviews
mouse sod2 forward 50 taacgcgcagatcatgcagctg - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

96
Proteintech anti human mouse sod2
GeoMx DSP was used to concurrently analyze the transcriptome of stationary and reactive AT-MSC in FFPE tissue sections obtained from 3 weeks after transplantation in the tissues around the fistula wound. GeoMx gene expression data of AT-MSC was analyzed for cell classification using xCell (C). Pre-ranked GSEA analysis was conducted using the GSEA software (GSEA 4.1.0) and results are presented in dot plot D. Positive normalized enrichment scores (NES) are enriched in reactive AT-MSC (D) while negative NES are enriched in stationary AT-MSC (D). Pathway enrichment analysis using STRING was applied to all significantly downregulated genes (blue data points in A-B), which are up regulated in stationary cells (n=115; adjP-Value < 0.05) and results are presented in dot plot E. Expression of <t>SOD2</t> in AT-MSC is further validated using immunofluorescence staining in F-G. Representative images of AT-MSC in the fistula tract expressing eGFP in green, nuclear staining with DAPI in blue and anti-SOD2 in red. Colocalization of SOD2 (white in G) and GFP (green in G) in AT-MSC was demonstrated using confocal microscopy. The xy image is on the plan indicated by the horizontal and vertical lines shown in the xz and yz images, respectively, and the original magnification was X40 (G). Scale bars: 100µm (F), and 10µm in G.
Anti Human Mouse Sod2, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti human mouse sod2/product/Proteintech
Average 96 stars, based on 1 article reviews
anti human mouse sod2 - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

Image Search Results


Contribution of superoxide to the EPR signal decay rate in vivo. (A) Western blot of expression of SOD2 in wild-type 4T1 breast cancer cell and 4T1 cells transfected with a plasmid encoding SOD 2, after passages 1, 4 and 6. Student's t-test, n = 3, ∗∗; p < 0.01 (B) Decay rates of nitroxides in vivo for 4T1-SOD2 tumors compared to wild-type 4T1 tumors. Bars represent means ± SEM. n = 6/group, Student's t-test, ∗; p < 0.05. (C) EPR signal decay of MitoTEMPO (25 μmol/kg) in vivo. Points represent means ± SEM. n = 6/group, two-way ANOVA with Sidak's correction, ∗; p < 0.05.

Journal: Redox Biology

Article Title: Noninvasive in vivo discrimination between mitochondrial ROS and global ROS production in solid tumors using EPR spectroscopy

doi: 10.1016/j.redox.2025.103871

Figure Lengend Snippet: Contribution of superoxide to the EPR signal decay rate in vivo. (A) Western blot of expression of SOD2 in wild-type 4T1 breast cancer cell and 4T1 cells transfected with a plasmid encoding SOD 2, after passages 1, 4 and 6. Student's t-test, n = 3, ∗∗; p < 0.01 (B) Decay rates of nitroxides in vivo for 4T1-SOD2 tumors compared to wild-type 4T1 tumors. Bars represent means ± SEM. n = 6/group, Student's t-test, ∗; p < 0.05. (C) EPR signal decay of MitoTEMPO (25 μmol/kg) in vivo. Points represent means ± SEM. n = 6/group, two-way ANOVA with Sidak's correction, ∗; p < 0.05.

Article Snippet: Lipofectamine (Thermo Scientific, Merelbeke, Belgium) was used in antibiotic-free media to transfect a plasmid encoding SOD2 (Sino Biological, catalog # HG12061-CY, Heschborn, Germany) according to the manufacturer's protocol.

Techniques: In Vivo, Western Blot, Expressing, Transfection, Plasmid Preparation

High level of epinephrine induces intracellular oxidative stress in oral keratinocytes. (A) HOK-16B cells treated with PBS or epinephrine for 24 h were subjected to CellROX staining. Nuclear DAPI signal is shown in blue (left). The relative CellROX signal intensities are shown (right). Each symbol means an individual cell. (B) Immunoblot analysis of SOD2 and SESN2 in HOK-16B cells treated with epinephrine for 24 h. β ACTIN was used as loading control. (C) Relative band intensities are shown. (D) Relative mRNA expression of TNFα, IL6, and IL8 in HOK-16B cells treated with epinephrine for 3 h. ** P < 0.01; *** P < 0.001. n.s , not significant.

Journal: Animal Cells and Systems

Article Title: Epinephrine as a potential driver of oral lichen planus pathogenesis

doi: 10.1080/19768354.2025.2588914

Figure Lengend Snippet: High level of epinephrine induces intracellular oxidative stress in oral keratinocytes. (A) HOK-16B cells treated with PBS or epinephrine for 24 h were subjected to CellROX staining. Nuclear DAPI signal is shown in blue (left). The relative CellROX signal intensities are shown (right). Each symbol means an individual cell. (B) Immunoblot analysis of SOD2 and SESN2 in HOK-16B cells treated with epinephrine for 24 h. β ACTIN was used as loading control. (C) Relative band intensities are shown. (D) Relative mRNA expression of TNFα, IL6, and IL8 in HOK-16B cells treated with epinephrine for 3 h. ** P < 0.01; *** P < 0.001. n.s , not significant.

Article Snippet: After blocking with 5% non-fat dried milk in Tris-buffered saline with TweenTM 20 (TBST) (10 mM Tris, pH 8.0, 150 mM NaCl and 0.5% Tween 20) for 30 min, membranes were incubated with antibodies against phospho STAT3 (1:1000, Cell signaling, Danvers, MA, USA, cat no. 9145), total STAT3 (1:1000, Cell signaling, cat no. 8768), β ACTIN (1:5000, Sigma Aldrich, cat no. A5316), phospho ERK (1:1000, Thermo Fisher Scientific, Waltham, MA, USA, cat no. MA5-15174), total ERK (1:1000, Cell signaling, cat no. 4695), phospho AKT (1:1000, Cell signaling, cat no. 4058), total AKT (1:1000, Cell signaling, cat no. 9272), BCL2 (1:1000, Bioworld Technology, China, cat no. BS1511), SOD2 (1:1000, Cusabio, Houston, TX, USA, cat no. CSB-PA022398LA01HU), and SESN2 (1:1000, Abcam, Cambridge, UK, cat no. ab178518) overnight at 4°C.

Techniques: Staining, Western Blot, Control, Expressing

Fig. 7. Kaempferol inhibits autophagy and attenuates oxidative stress in RA-FLS cells. (A) RA-FLS cells were treated with different concentrations of kaempferol, cellular reactive oxygen species were detected by DCFH- DA, and cell membrane potential was detected by JC-1, Scale bar is 100 μm. (B) RA-FLS cells were treated with different concentrations of kaempferol and protein expression of SOD2 was detected by Western blot. (C) In different concentrations of kaempferol-treated RA-FLS cells, Western blot detected protein expression of P62, LC3B. *P < 0.05; **P < 0.01; ***P < 0.001.

Journal: Scientific reports

Article Title: Probing the molecular mechanism of kaempferol in relieving rheumatoid arthritis based on network pharmacology.

doi: 10.1038/s41598-025-91311-6

Figure Lengend Snippet: Fig. 7. Kaempferol inhibits autophagy and attenuates oxidative stress in RA-FLS cells. (A) RA-FLS cells were treated with different concentrations of kaempferol, cellular reactive oxygen species were detected by DCFH- DA, and cell membrane potential was detected by JC-1, Scale bar is 100 μm. (B) RA-FLS cells were treated with different concentrations of kaempferol and protein expression of SOD2 was detected by Western blot. (C) In different concentrations of kaempferol-treated RA-FLS cells, Western blot detected protein expression of P62, LC3B. *P < 0.05; **P < 0.01; ***P < 0.001.

Article Snippet: After electrophoresis, the SDS-PAGE gel was removed, and a polyvinylidene difluoride membrane (PVDF, Merck Millipore, Germany) was activated and placed on the top layer of the gel, and the blot was transferred to the PVDF membrane by electrotransferring the blot at 200 mA for 2 h. Subsequently, the membranes were blocked with 5% skimmed milk for 2 h. Antibodies including glyceraldehyde-3-phosphate dehydrogenase(GAPDH) (Proteintech, #60,004–1-IG), phosphor-mitogen-activated protein kinase (P-MAPK) (Wanleibio, #WL01813), mitogen-activated protein kinase (MAPK) (Wanleibio, #WL05246), peroxisome proliferator-activated receptor gamma (PPARG) (Wanleibio, #WL01800), phosphor-nuclear factor kappa-light-chain-enhancer of activated B cells (P-NFKB) (Wanleibio, #WL02169), NFKB (Bioss, # bsm-33117 M), NLRP3 (Bioss, #bs-41293R), IL1β (Wanleibio, #WLH3903), uperoxide dismutase (SOD2) (Boster, #BA4566), microtubule-associated protein 1 light chain 3 beta (LC3B) (Cell signaling technology, #12,741), P62 (Cell signaling technology, #16177S), and proliferating cell nuclear antigen (PCNA) (Proteintech, #10,205–2-AP) used.

Techniques: Membrane, Expressing, Western Blot

Fig. 8. Kaempferol inhibits cellular autophagy through the MAPK8/NLRP3 pathway to attenuate the abnormal proliferation and inflammation of RA-FLS. (A) Different concentrations of kaempferol were treated with RA- FLS cells, and the protein expression of P-MAPK8 and MAPK8 were detected by Western blot. (B) In different concentrations of kaempferol-treated RA-FLS cells, Western blot detected protein expression of NLRP3, IL-1β. (C) Overexpression of MAPK8 and kaempferol treated RA-FLS cells, Western blot detected protein expression of NLRP3, IL-1β, PCNA, SOD2. (D) Overexpression of MAPK8 with kaempferol-treated RA-FLS cells and immunofluorescence detection of LC3B protein expression, Scale bar is 50 μm. (E) Overexpression of MAPK8 with kaempferol-treated RA-FLS cells and immunofluorescence detection of P62 protein expression, Scale bar is 50 μm. *P < 0.05; **P < 0.01; ***P < 0.001.

Journal: Scientific reports

Article Title: Probing the molecular mechanism of kaempferol in relieving rheumatoid arthritis based on network pharmacology.

doi: 10.1038/s41598-025-91311-6

Figure Lengend Snippet: Fig. 8. Kaempferol inhibits cellular autophagy through the MAPK8/NLRP3 pathway to attenuate the abnormal proliferation and inflammation of RA-FLS. (A) Different concentrations of kaempferol were treated with RA- FLS cells, and the protein expression of P-MAPK8 and MAPK8 were detected by Western blot. (B) In different concentrations of kaempferol-treated RA-FLS cells, Western blot detected protein expression of NLRP3, IL-1β. (C) Overexpression of MAPK8 and kaempferol treated RA-FLS cells, Western blot detected protein expression of NLRP3, IL-1β, PCNA, SOD2. (D) Overexpression of MAPK8 with kaempferol-treated RA-FLS cells and immunofluorescence detection of LC3B protein expression, Scale bar is 50 μm. (E) Overexpression of MAPK8 with kaempferol-treated RA-FLS cells and immunofluorescence detection of P62 protein expression, Scale bar is 50 μm. *P < 0.05; **P < 0.01; ***P < 0.001.

Article Snippet: After electrophoresis, the SDS-PAGE gel was removed, and a polyvinylidene difluoride membrane (PVDF, Merck Millipore, Germany) was activated and placed on the top layer of the gel, and the blot was transferred to the PVDF membrane by electrotransferring the blot at 200 mA for 2 h. Subsequently, the membranes were blocked with 5% skimmed milk for 2 h. Antibodies including glyceraldehyde-3-phosphate dehydrogenase(GAPDH) (Proteintech, #60,004–1-IG), phosphor-mitogen-activated protein kinase (P-MAPK) (Wanleibio, #WL01813), mitogen-activated protein kinase (MAPK) (Wanleibio, #WL05246), peroxisome proliferator-activated receptor gamma (PPARG) (Wanleibio, #WL01800), phosphor-nuclear factor kappa-light-chain-enhancer of activated B cells (P-NFKB) (Wanleibio, #WL02169), NFKB (Bioss, # bsm-33117 M), NLRP3 (Bioss, #bs-41293R), IL1β (Wanleibio, #WLH3903), uperoxide dismutase (SOD2) (Boster, #BA4566), microtubule-associated protein 1 light chain 3 beta (LC3B) (Cell signaling technology, #12,741), P62 (Cell signaling technology, #16177S), and proliferating cell nuclear antigen (PCNA) (Proteintech, #10,205–2-AP) used.

Techniques: Expressing, Western Blot, Over Expression, Immunofluorescence

Multiple fluorescence staining of tissues samples from ESCC patients. (A, B) Validation of high and low expression level of c5_TYMS in ESCC tumor tissues samples and spatial distribution with microphages and fibroblasts. (C, D) Validation of high and low expression of level c4_SOD2 in ESCC tumor tissue samples and spatial distribution with microphages and fibroblasts.

Journal: Frontiers in Immunology

Article Title: Single-cell sequencing analysis reveals cancer-associated pericyte subgroup in esophageal squamous cell carcinoma to predict prognosis

doi: 10.3389/fimmu.2024.1474673

Figure Lengend Snippet: Multiple fluorescence staining of tissues samples from ESCC patients. (A, B) Validation of high and low expression level of c5_TYMS in ESCC tumor tissues samples and spatial distribution with microphages and fibroblasts. (C, D) Validation of high and low expression of level c4_SOD2 in ESCC tumor tissue samples and spatial distribution with microphages and fibroblasts.

Article Snippet: Incubate overnight at 4°C with purified rabbit anti-human PDGFRβ (ab32570, 1:100, Abcam, USA), rabbit anti-human SOD2 (66474-1-Ig, 1:300, Proteintech, Wuhan, China), rabbit anti-human CD68 (66231-2-Ig, 1:2000, Proteintech, Wuhan, China), rabbit anti-human TYMS (66725-1-Ig, 1:200, Proteintech, Wuhan, China), mouse anti-human α-SMA(67735-1-Ig, 1:400, Proteintech, Wuhan, China) and purified rabbit anti-human EPCAM (21050-1-AP, 1:1000, Proteintech, Wuhan, China).

Techniques: Fluorescence, Staining, Biomarker Discovery, Expressing

Docking results of available proteins with small molecules.

Journal: Frontiers in Immunology

Article Title: Single-cell sequencing analysis reveals cancer-associated pericyte subgroup in esophageal squamous cell carcinoma to predict prognosis

doi: 10.3389/fimmu.2024.1474673

Figure Lengend Snippet: Docking results of available proteins with small molecules.

Article Snippet: Incubate overnight at 4°C with purified rabbit anti-human PDGFRβ (ab32570, 1:100, Abcam, USA), rabbit anti-human SOD2 (66474-1-Ig, 1:300, Proteintech, Wuhan, China), rabbit anti-human CD68 (66231-2-Ig, 1:2000, Proteintech, Wuhan, China), rabbit anti-human TYMS (66725-1-Ig, 1:200, Proteintech, Wuhan, China), mouse anti-human α-SMA(67735-1-Ig, 1:400, Proteintech, Wuhan, China) and purified rabbit anti-human EPCAM (21050-1-AP, 1:1000, Proteintech, Wuhan, China).

Techniques: Binding Assay

Molecular docking results of predicted drugs and protein encoded by target genes. (A) PDGFRβ and docetaxel. (B) TYMS and docetaxel. (C) PDGFRβ and cytarabine. (D) TYMS and cytarabine. (E) PDGFRβ and bisindolylmalemide. (F) SOD2 and bisindolylma-leimide. (G) PDGFRβ and raloxifene. (H) SOD2 and raloxifene.

Journal: Frontiers in Immunology

Article Title: Single-cell sequencing analysis reveals cancer-associated pericyte subgroup in esophageal squamous cell carcinoma to predict prognosis

doi: 10.3389/fimmu.2024.1474673

Figure Lengend Snippet: Molecular docking results of predicted drugs and protein encoded by target genes. (A) PDGFRβ and docetaxel. (B) TYMS and docetaxel. (C) PDGFRβ and cytarabine. (D) TYMS and cytarabine. (E) PDGFRβ and bisindolylmalemide. (F) SOD2 and bisindolylma-leimide. (G) PDGFRβ and raloxifene. (H) SOD2 and raloxifene.

Article Snippet: Incubate overnight at 4°C with purified rabbit anti-human PDGFRβ (ab32570, 1:100, Abcam, USA), rabbit anti-human SOD2 (66474-1-Ig, 1:300, Proteintech, Wuhan, China), rabbit anti-human CD68 (66231-2-Ig, 1:2000, Proteintech, Wuhan, China), rabbit anti-human TYMS (66725-1-Ig, 1:200, Proteintech, Wuhan, China), mouse anti-human α-SMA(67735-1-Ig, 1:400, Proteintech, Wuhan, China) and purified rabbit anti-human EPCAM (21050-1-AP, 1:1000, Proteintech, Wuhan, China).

Techniques:

GeoMx DSP was used to concurrently analyze the transcriptome of stationary and reactive AT-MSC in FFPE tissue sections obtained from 3 weeks after transplantation in the tissues around the fistula wound. GeoMx gene expression data of AT-MSC was analyzed for cell classification using xCell (C). Pre-ranked GSEA analysis was conducted using the GSEA software (GSEA 4.1.0) and results are presented in dot plot D. Positive normalized enrichment scores (NES) are enriched in reactive AT-MSC (D) while negative NES are enriched in stationary AT-MSC (D). Pathway enrichment analysis using STRING was applied to all significantly downregulated genes (blue data points in A-B), which are up regulated in stationary cells (n=115; adjP-Value < 0.05) and results are presented in dot plot E. Expression of SOD2 in AT-MSC is further validated using immunofluorescence staining in F-G. Representative images of AT-MSC in the fistula tract expressing eGFP in green, nuclear staining with DAPI in blue and anti-SOD2 in red. Colocalization of SOD2 (white in G) and GFP (green in G) in AT-MSC was demonstrated using confocal microscopy. The xy image is on the plan indicated by the horizontal and vertical lines shown in the xz and yz images, respectively, and the original magnification was X40 (G). Scale bars: 100µm (F), and 10µm in G.

Journal: bioRxiv

Article Title: Human adipose-derived mesenchymal stromal cells improved wound healing in enterocutaneous fistulizing disease mouse model

doi: 10.1101/2024.11.07.622127

Figure Lengend Snippet: GeoMx DSP was used to concurrently analyze the transcriptome of stationary and reactive AT-MSC in FFPE tissue sections obtained from 3 weeks after transplantation in the tissues around the fistula wound. GeoMx gene expression data of AT-MSC was analyzed for cell classification using xCell (C). Pre-ranked GSEA analysis was conducted using the GSEA software (GSEA 4.1.0) and results are presented in dot plot D. Positive normalized enrichment scores (NES) are enriched in reactive AT-MSC (D) while negative NES are enriched in stationary AT-MSC (D). Pathway enrichment analysis using STRING was applied to all significantly downregulated genes (blue data points in A-B), which are up regulated in stationary cells (n=115; adjP-Value < 0.05) and results are presented in dot plot E. Expression of SOD2 in AT-MSC is further validated using immunofluorescence staining in F-G. Representative images of AT-MSC in the fistula tract expressing eGFP in green, nuclear staining with DAPI in blue and anti-SOD2 in red. Colocalization of SOD2 (white in G) and GFP (green in G) in AT-MSC was demonstrated using confocal microscopy. The xy image is on the plan indicated by the horizontal and vertical lines shown in the xz and yz images, respectively, and the original magnification was X40 (G). Scale bars: 100µm (F), and 10µm in G.

Article Snippet: Incubation with primary antibodies included: rabbit anti-human CD45 (1:25) (Abcam, Cambridge, UK), rat anti-mouse CD45 (1:50) (Abcam, Cambridge, UK), rabbit anti-GFP (1:100) (Abcam, Cambridge, UK), or rabbit anti-human/mouse SOD2 (Proteintech, Rosemont, Illinois, USA) with 2% normal donkey serum (NDS), overnight at 4 °C.

Techniques: Transplantation Assay, Expressing, Software, Immunofluorescence, Staining, Confocal Microscopy